Review



single cell rna sequencing  (10X Genomics)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    10X Genomics single cell rna sequencing
    Data summary. (A) Schematic of sample and data processing. Numbers denote the number of samples; amplification of TP53 loci enabled targeted genotyping of known TP53 mutation sites (Supporting Information S2: Methods, ). Image created with BioRender. (B) ERCC6L2 disease (ED) and Shwachman–Diamond (SDS) blood and bone marrow (BM) samples included in this study, depicted at their different stages of disease. Numbers denote the number of samples obtained from 10 ED and 5 SDS patients for BM, and from 12 ED and 5 SDS patients for blood. Colors depict the type of samples (BM or blood). Samples with “no TP53 ” denote samples without somatic TP53 mutations, and other samples depict cases with 1–4 TP53 mutations. (C) Detected cell types of our <t>integrated</t> <t>single‐cell</t> transcriptomics data. (D) TP53 mutation status of cells. Numbers denote the number of cells that were identified as TP53 ‐mutated or TP53 wild‐type. AML, acute myeloid leukemia; BMF, bone marrow failure; HC, healthy control; HSC, hematopoietic stem cell; LMP, lymphomyeloid progenitor; MDS, myelodysplastic syndrome; MPP, multipotent progenitor cell; VAF, variant allele fraction.
    Single Cell Rna Sequencing, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-+cell+rna+sequencing/pmc13270343-36-5-10
    Average 86 stars, based on 1 article reviews
    single cell rna sequencing - by Bioz Stars, 2026-10
    86/100 stars

    Images

    1) Product Images from "Distinct stem cell identities converge into shared erythroid stress in ERCC6L2 disease and Shwachman–Diamond syndrome"

    Article Title: Distinct stem cell identities converge into shared erythroid stress in ERCC6L2 disease and Shwachman–Diamond syndrome

    Journal: HemaSphere

    doi: 10.1002/hem3.70374

    Data summary. (A) Schematic of sample and data processing. Numbers denote the number of samples; amplification of TP53 loci enabled targeted genotyping of known TP53 mutation sites (Supporting Information S2: Methods, ). Image created with BioRender. (B) ERCC6L2 disease (ED) and Shwachman–Diamond (SDS) blood and bone marrow (BM) samples included in this study, depicted at their different stages of disease. Numbers denote the number of samples obtained from 10 ED and 5 SDS patients for BM, and from 12 ED and 5 SDS patients for blood. Colors depict the type of samples (BM or blood). Samples with “no TP53 ” denote samples without somatic TP53 mutations, and other samples depict cases with 1–4 TP53 mutations. (C) Detected cell types of our integrated single‐cell transcriptomics data. (D) TP53 mutation status of cells. Numbers denote the number of cells that were identified as TP53 ‐mutated or TP53 wild‐type. AML, acute myeloid leukemia; BMF, bone marrow failure; HC, healthy control; HSC, hematopoietic stem cell; LMP, lymphomyeloid progenitor; MDS, myelodysplastic syndrome; MPP, multipotent progenitor cell; VAF, variant allele fraction.
    Figure Legend Snippet: Data summary. (A) Schematic of sample and data processing. Numbers denote the number of samples; amplification of TP53 loci enabled targeted genotyping of known TP53 mutation sites (Supporting Information S2: Methods, ). Image created with BioRender. (B) ERCC6L2 disease (ED) and Shwachman–Diamond (SDS) blood and bone marrow (BM) samples included in this study, depicted at their different stages of disease. Numbers denote the number of samples obtained from 10 ED and 5 SDS patients for BM, and from 12 ED and 5 SDS patients for blood. Colors depict the type of samples (BM or blood). Samples with “no TP53 ” denote samples without somatic TP53 mutations, and other samples depict cases with 1–4 TP53 mutations. (C) Detected cell types of our integrated single‐cell transcriptomics data. (D) TP53 mutation status of cells. Numbers denote the number of cells that were identified as TP53 ‐mutated or TP53 wild‐type. AML, acute myeloid leukemia; BMF, bone marrow failure; HC, healthy control; HSC, hematopoietic stem cell; LMP, lymphomyeloid progenitor; MDS, myelodysplastic syndrome; MPP, multipotent progenitor cell; VAF, variant allele fraction.

    Techniques Used: Amplification, Mutagenesis, Single-cell Transcriptomics, Control, Variant Assay

    Transcriptional landscape of bone marrow (BM) erythroid progenitors, peripheral blood cells, and fibroblasts in ERCC6L2 disease (ED) compared to Shwachman–Diamond syndrome (SDS). (A) Comparison of ED bone marrow failure (BMF) and SDS BMF differentially expressed genes (DEGs) showing log 2 fold changes (log 2 FC) of expression in ED BMF ( n samples = 12) and SDS BMF ( n samples = 4) against healthy controls ( n samples = 63) in BM hematopoietic stem cell (HSC) and multipotent progenitor cell (MPP) ( n cells = 370; 30; 27 for healthy control, ED BMF and SDS BMF, respectively), erythroid–myeloid progenitor (EMP) ( n cells = 1579; 140; 62), early erythroid progenitor (EEP) ( n cells = 11,826; 777; 232), and late erythroid progenitor (LEP) ( n cells = 2422; 858; 385). Genes falling close to the diagonal exhibit similar magnitude and direction of differential expression in both diseases, whereas genes deviating from the diagonal reflect differences in the extent of dysregulation between ED and SDS. Blue points indicate genes concordantly regulated in both conditions (upregulated or downregulated relative to controls), while orange points indicate genes regulated in opposite directions between ED and SDS. (B) Top 10 non‐redundant pathways across cell types for BM. Enriched pathways were sorted by FDR‐adjusted P‐values P adj . Redundant pathways (pathways containing DEGs of which more than half of the DEGs are members of a pathway with a smaller P adj ) and pathways not enriched for one of the cell types were filtered out. From the remaining pathways, the top 10 based on the smallest P adj across cell types were plotted. (C) Hematopoietic‐ and erythroid‐specific pathway enrichment in ED BMF and SDS BMF. Reactome pathway enrichment analysis focusing on pathways related to hematopoiesis and erythropoiesis in bulk blood RNA‐seq data. Pathways were selected based on lineage relevance and the presence of multiple significantly differentially expressed genes, thereby excluding pathways driven by single‐gene effects. Shown are pathways significantly enriched in ED BMF and SDS BMF compared to healthy controls, with adjusted P‐values indicated. (D) Comparison of ED BMF and SDS BMF DEGs showing log 2 FC of expression in ED BMF ( n = 28) and SDS BMF ( n = 7) against healthy controls ( n = 11) in blood samples. (E) Top five enriched pathways in ED BMF and SDS BMF compared to healthy controls in blood samples. (F) Comparison of ED and SDS DEGs showing log 2 FC of expression in ED ( n = 74) and SDS ( n = 55) against healthy controls ( n = 68) in fibroblast samples. (G) Top five enriched pathways on ED and SDS compared to healthy controls in fibroblasts. FDR, false discovery rate; HC, healthy control; R , Pearson correlation coefficient. DEGs, genes with P adj < 0.05 in the differential expression (DE) analysis results. Enriched pathways, pathways with P adj < 0.05 in pathway analysis results. DEGs were obtained using MAST for BM in (A) and using DESeq2 for blood in (D) and fibroblast (F) and enriched pathways were obtained using enrichR for BM (B, C) , blood (E) , and fibroblasts (G) .
    Figure Legend Snippet: Transcriptional landscape of bone marrow (BM) erythroid progenitors, peripheral blood cells, and fibroblasts in ERCC6L2 disease (ED) compared to Shwachman–Diamond syndrome (SDS). (A) Comparison of ED bone marrow failure (BMF) and SDS BMF differentially expressed genes (DEGs) showing log 2 fold changes (log 2 FC) of expression in ED BMF ( n samples = 12) and SDS BMF ( n samples = 4) against healthy controls ( n samples = 63) in BM hematopoietic stem cell (HSC) and multipotent progenitor cell (MPP) ( n cells = 370; 30; 27 for healthy control, ED BMF and SDS BMF, respectively), erythroid–myeloid progenitor (EMP) ( n cells = 1579; 140; 62), early erythroid progenitor (EEP) ( n cells = 11,826; 777; 232), and late erythroid progenitor (LEP) ( n cells = 2422; 858; 385). Genes falling close to the diagonal exhibit similar magnitude and direction of differential expression in both diseases, whereas genes deviating from the diagonal reflect differences in the extent of dysregulation between ED and SDS. Blue points indicate genes concordantly regulated in both conditions (upregulated or downregulated relative to controls), while orange points indicate genes regulated in opposite directions between ED and SDS. (B) Top 10 non‐redundant pathways across cell types for BM. Enriched pathways were sorted by FDR‐adjusted P‐values P adj . Redundant pathways (pathways containing DEGs of which more than half of the DEGs are members of a pathway with a smaller P adj ) and pathways not enriched for one of the cell types were filtered out. From the remaining pathways, the top 10 based on the smallest P adj across cell types were plotted. (C) Hematopoietic‐ and erythroid‐specific pathway enrichment in ED BMF and SDS BMF. Reactome pathway enrichment analysis focusing on pathways related to hematopoiesis and erythropoiesis in bulk blood RNA‐seq data. Pathways were selected based on lineage relevance and the presence of multiple significantly differentially expressed genes, thereby excluding pathways driven by single‐gene effects. Shown are pathways significantly enriched in ED BMF and SDS BMF compared to healthy controls, with adjusted P‐values indicated. (D) Comparison of ED BMF and SDS BMF DEGs showing log 2 FC of expression in ED BMF ( n = 28) and SDS BMF ( n = 7) against healthy controls ( n = 11) in blood samples. (E) Top five enriched pathways in ED BMF and SDS BMF compared to healthy controls in blood samples. (F) Comparison of ED and SDS DEGs showing log 2 FC of expression in ED ( n = 74) and SDS ( n = 55) against healthy controls ( n = 68) in fibroblast samples. (G) Top five enriched pathways on ED and SDS compared to healthy controls in fibroblasts. FDR, false discovery rate; HC, healthy control; R , Pearson correlation coefficient. DEGs, genes with P adj < 0.05 in the differential expression (DE) analysis results. Enriched pathways, pathways with P adj < 0.05 in pathway analysis results. DEGs were obtained using MAST for BM in (A) and using DESeq2 for blood in (D) and fibroblast (F) and enriched pathways were obtained using enrichR for BM (B, C) , blood (E) , and fibroblasts (G) .

    Techniques Used: Comparison, Expressing, Control, Quantitative Proteomics, RNA Sequencing

    Related Articles

    Single Cell:

    Article Title: The developing leaf of the wild grass Brachypodium distachyon at single-cell resolution.
    Article Snippet: .. Then, cell wall digestion released 1 protoplasts (Fig. S1A,B,C), which were used for droplet-based 10X Genomics single-cell 2 RNA-sequencing (scRNA-seq). ..

    Article Title: Organoid modeling of lung branching morphogenesis and epithelial lineage specification.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-TTF1 Abcam Cat#ab76013; RRID:AB_1310784 Mouse monoclonal anti-Hop Antibody (E-1) Santa Cruz Biotechnology Cat#sc-398703; RRID:AB_2687966 Rabbit polyclonal anti-SFTPC Invitrogen Cat#PA5-102493; RRID: AB_2851895 Mouse monoclonal anti-RAGE R&D Cat#MAB1179; RRID:AB_2289349 Rabbit polyclonal anti-Sox9 Milipore Cat# AB5535; RRID: AB_2239761 Rabbit monoclonal anti-Sox2 Cell Signaling Technology Cat#23064; RRID: AB_2714146 Mouse polyclonal anti-ICAM-1 R&D Cat# AF796; RRID: AB_2248703 Hamster monoclonal anti-PDPN DSHB Cat#8.1.1; RRID: AB_531893 Rabbit monoclonal anti- PDGFR alpha Abcam Cat# ab203491; RRID: AB_2892065 Goat polyclonal anti-CD31 R&D Cat# AF3628; RRID: AB_2161028 Mouse monoclonal anti-acetylated Tubulin Sigma Cat# T7451;RRID: AB_609894 Mouse monoclonal anti-CC10(E-11) Santa Cruz Biotechnology Cat# sc365992; RRID: AB_10915481 Donkey polyclonal anti-rabbit IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat# A10042; RRID: AB_2534017 Donkey polyclonal anti-goat IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat# A-21447; RRID: AB_2535864 Donkey polyclonal anti-rat IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat# A78946; RRID: AB_2910653 Goat polyclonal anti- hamster IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat#A21451; RRID: AB_2535868 Donkey polyclonal anti-mouse IgG (H+L) (Alexa Fluor® 488) Thermo Fisher Cat#A21202; RRID: AB_141607 Donkey polyclonal anti-mouse IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat#A10037; RRID: AB_11180865 Donkey polyclonal anti-rabbit IgG (H+L) (Alexa Fluor® 488) Thermo Fisher Cat#A21206; RRID: AB_2535792 Goat polyclonal anti-rat IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat#A21247; RRID: AB_141778 Biological samples Mouse lung This paper N/A Chemicals, peptides, and recombinant proteins Dispase II Gibco Cat#17105-041 Matrigel Corning Cat#354234 DMEM/F12 Gibco Cat#11330032 N2 supplement Gibco Cat#17502-048 B27 Gibco Cat#17504-044 Penicilin-Streptomycin Gibco Cat#15140-122 CHIR99021 Targetmol Cat#T2310; FGF7 R&D Cat#251 FGF10 Peprotech Cat#100-26 BMP4 R&D Cat# 314-BP TGF-β1 Peprotech Cat#100-21 SHH R&D Cat# 464-SH Roxadustat Selleck Cat#S1007; Vitamin C Sigma Cat#49752 Monothioglycerol Sigma Cat#M6145 EPZ5676 Targetmol Cat#T3099; RA MCE Cat# HY-14649; EGF R&D Cat#2028-EG-200 Bleomycin sulfate Macklin Cat#B802467; Papain Worthington Cat#LS003126 BSA Miltenyi Biotec Cat#130-091-376 (Continued on next page) ll OPEN ACCESS Article e1 Developmental Cell 61, 1–17.e1–e8, July 8, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER TRIzol Reagent Invitrogen Cat#TR118 fetal bovine serum NTC Cat#SFBE Liberase TM Roche Cat#LIBTM-RO DNase I Worthington Biochemicals Cat#LS006343 ACK lysing buffer ThermoFisher Cat#A1049201 4% paraformaldehyde Coolaber Cat#SL1830 sucrose solutions Macklin Cat#:C17413261; OCT Sakura Cat#4583 TritonX-100 Yeasen Cat#20107ES20; PBS Cytiva Cat#SH30256.01 SPY-555-FastActTM Cytoskeleton Cat#SC205 DAPI Invitrogen Cat#D1306 Critical commercial assays Chromium Next GEM Single Cell 3′ GEM, Library & Gel Bead Kit v3.1 10X Genomics CatPN-1000121 VAHTS mRNA-seq v2 Library Prep Kit for Illumina Vazyme Cat#NR605 Masson‘s trichrome staining kit Solarbio Cat# G1346 Deposited data RNA sequencing data (raw and analyzed data) This paper GSE303739 scRNAseq sequencing data (raw and analyzed data) This paper GSE303739 Public scRNA-seq data Negretti et al.46 GSE165063 Public scRNA-seq data Zepp et al.47 GSE149563 Public scRNA-seq data Strunz et al.48 GSE141259 Public scRNA-seq data Angelidis et al.49 GSE124872 Experimental models: Organisms/strains Mouse: C57/6J Rosa26-mTmG The Jackson Laboratory RRID:IMSR_JAX007576 Mouse: CD-1®(ICR) IGS Guangdong Vital River Laboratory Animal Technology Co., Ltd. No.201 Mouse: C57BL/6J GemPharmatech Co., Ltd. No. N000013 Software and algorithms Napari(v0.5.4) N/A https://www.python.org/ Fiji Schneider et al.51 https://imagej.net/software/fiji/ Networkx(v3.4.2) Hagberg and Conway52 https://github.com/networkx/networkx Umap-learn(v0.5.7) McInnes et al.53 https://umap-learn.readthedocs. io/en/latest/ micro-SAM(v1.3.1) Archit et al.54 https://github.com/computational- cell-analytics/micro-sam Matplotlib(v3.1.0) Hunter et al.55 https://matplotlib.org/stable/ FlowJo (v10.8.1) BD Biosciences N/A Bowtie2 N/A http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml RSEM N/A https://github.com/deweylab/RSEM STAR (v2.7.6a) N/A https://github.com/alexdobin/STAR R (v4.2.2) R Core Team https://www.r-project.org/ ggplot2 (v3.3.2) N/A https://github.com/tidyverse/ggplot2 Seurat (v4.3.0) N/A http://www.satijalab.org/seurat Python (v3.11) Python Software Foundation https://www.python.org/ Scanpy (v1.9.6) N/A https://scanpy.readthedocs.io/en/stable/ scVI (v1.4.1) N/A https://scvi-tools.org/ (Continued on next page) ll OPEN ACCESSArticle Developmental Cell 61, 1–17.e1–e8, July 8, 2026 e2 ..

    Article Title: Urine IRF4/PENK/PXDN Methylation Signatures Enable Machine Learning-Driven Bladder Cancer Detection and Microenvironment Dissection.
    Article Snippet: .. To characterize the cell-type-specific expression patterns of IRF4, PENK, and PXDN in BC, we analyzed the publicly available single-cell RNA sequencing (scRNA-seq) dataset GSE267718 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi? acc=GSE267718), generated using the 10X Genomics platform. ..

    Article Title: Loss of the Y chromosome drives epigenetic and transcriptomic plasticity in lung adenocarcinoma
    Article Snippet: We sorted live, single-cell-gated CD45 + and CD45 neg cells using a FACSAria II cell sorter (BD Biosciences). .. The sorted CD45 + and CD45 neg cells derived from paired distal normal lung and lung adenocarcinoma samples were used for single-cell RNA sequencing analysis (10X Genomics, Single Cell 3′ Gene Expression v3.1). .. Approximately 5,000 cells per donor, derived from the same tissue type (distal normal or tumor) and sorted compartment (CD45 + and CD45 neg ), were combined (20,000 cells in total from 4 donors per well) and loaded in each well of the Chromium Next GEM Chip G (10X Genomics).

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    RNA sequencing:

    Article Title: The developing leaf of the wild grass Brachypodium distachyon at single-cell resolution.
    Article Snippet: .. Then, cell wall digestion released 1 protoplasts (Fig. S1A,B,C), which were used for droplet-based 10X Genomics single-cell 2 RNA-sequencing (scRNA-seq). ..

    Control:

    Article Title: Multi-Omics Characterization of Human Molecular Responses to Spaceflight Across Two Independent Missions
    Article Snippet: For the GEX dataset, the sequenced reads were mapped using 10X Genomics reference version GRCh38 GEX 2020-A ( https://www.10xgenomics.com/support/software/cell-ranger/latest/release-notes/cr-reference-release-notes#2020-a , July 7, 2020, GENCODE v32/Ensembl 98). .. Metrics computed by 10X Genomics Cell Ranger were parsed and analyzed for quality control. ..

    Staining:

    Article Title: Organoid modeling of lung branching morphogenesis and epithelial lineage specification.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-TTF1 Abcam Cat#ab76013; RRID:AB_1310784 Mouse monoclonal anti-Hop Antibody (E-1) Santa Cruz Biotechnology Cat#sc-398703; RRID:AB_2687966 Rabbit polyclonal anti-SFTPC Invitrogen Cat#PA5-102493; RRID: AB_2851895 Mouse monoclonal anti-RAGE R&D Cat#MAB1179; RRID:AB_2289349 Rabbit polyclonal anti-Sox9 Milipore Cat# AB5535; RRID: AB_2239761 Rabbit monoclonal anti-Sox2 Cell Signaling Technology Cat#23064; RRID: AB_2714146 Mouse polyclonal anti-ICAM-1 R&D Cat# AF796; RRID: AB_2248703 Hamster monoclonal anti-PDPN DSHB Cat#8.1.1; RRID: AB_531893 Rabbit monoclonal anti- PDGFR alpha Abcam Cat# ab203491; RRID: AB_2892065 Goat polyclonal anti-CD31 R&D Cat# AF3628; RRID: AB_2161028 Mouse monoclonal anti-acetylated Tubulin Sigma Cat# T7451;RRID: AB_609894 Mouse monoclonal anti-CC10(E-11) Santa Cruz Biotechnology Cat# sc365992; RRID: AB_10915481 Donkey polyclonal anti-rabbit IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat# A10042; RRID: AB_2534017 Donkey polyclonal anti-goat IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat# A-21447; RRID: AB_2535864 Donkey polyclonal anti-rat IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat# A78946; RRID: AB_2910653 Goat polyclonal anti- hamster IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat#A21451; RRID: AB_2535868 Donkey polyclonal anti-mouse IgG (H+L) (Alexa Fluor® 488) Thermo Fisher Cat#A21202; RRID: AB_141607 Donkey polyclonal anti-mouse IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat#A10037; RRID: AB_11180865 Donkey polyclonal anti-rabbit IgG (H+L) (Alexa Fluor® 488) Thermo Fisher Cat#A21206; RRID: AB_2535792 Goat polyclonal anti-rat IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat#A21247; RRID: AB_141778 Biological samples Mouse lung This paper N/A Chemicals, peptides, and recombinant proteins Dispase II Gibco Cat#17105-041 Matrigel Corning Cat#354234 DMEM/F12 Gibco Cat#11330032 N2 supplement Gibco Cat#17502-048 B27 Gibco Cat#17504-044 Penicilin-Streptomycin Gibco Cat#15140-122 CHIR99021 Targetmol Cat#T2310; FGF7 R&D Cat#251 FGF10 Peprotech Cat#100-26 BMP4 R&D Cat# 314-BP TGF-β1 Peprotech Cat#100-21 SHH R&D Cat# 464-SH Roxadustat Selleck Cat#S1007; Vitamin C Sigma Cat#49752 Monothioglycerol Sigma Cat#M6145 EPZ5676 Targetmol Cat#T3099; RA MCE Cat# HY-14649; EGF R&D Cat#2028-EG-200 Bleomycin sulfate Macklin Cat#B802467; Papain Worthington Cat#LS003126 BSA Miltenyi Biotec Cat#130-091-376 (Continued on next page) ll OPEN ACCESS Article e1 Developmental Cell 61, 1–17.e1–e8, July 8, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER TRIzol Reagent Invitrogen Cat#TR118 fetal bovine serum NTC Cat#SFBE Liberase TM Roche Cat#LIBTM-RO DNase I Worthington Biochemicals Cat#LS006343 ACK lysing buffer ThermoFisher Cat#A1049201 4% paraformaldehyde Coolaber Cat#SL1830 sucrose solutions Macklin Cat#:C17413261; OCT Sakura Cat#4583 TritonX-100 Yeasen Cat#20107ES20; PBS Cytiva Cat#SH30256.01 SPY-555-FastActTM Cytoskeleton Cat#SC205 DAPI Invitrogen Cat#D1306 Critical commercial assays Chromium Next GEM Single Cell 3′ GEM, Library & Gel Bead Kit v3.1 10X Genomics CatPN-1000121 VAHTS mRNA-seq v2 Library Prep Kit for Illumina Vazyme Cat#NR605 Masson‘s trichrome staining kit Solarbio Cat# G1346 Deposited data RNA sequencing data (raw and analyzed data) This paper GSE303739 scRNAseq sequencing data (raw and analyzed data) This paper GSE303739 Public scRNA-seq data Negretti et al.46 GSE165063 Public scRNA-seq data Zepp et al.47 GSE149563 Public scRNA-seq data Strunz et al.48 GSE141259 Public scRNA-seq data Angelidis et al.49 GSE124872 Experimental models: Organisms/strains Mouse: C57/6J Rosa26-mTmG The Jackson Laboratory RRID:IMSR_JAX007576 Mouse: CD-1®(ICR) IGS Guangdong Vital River Laboratory Animal Technology Co., Ltd. No.201 Mouse: C57BL/6J GemPharmatech Co., Ltd. No. N000013 Software and algorithms Napari(v0.5.4) N/A https://www.python.org/ Fiji Schneider et al.51 https://imagej.net/software/fiji/ Networkx(v3.4.2) Hagberg and Conway52 https://github.com/networkx/networkx Umap-learn(v0.5.7) McInnes et al.53 https://umap-learn.readthedocs. io/en/latest/ micro-SAM(v1.3.1) Archit et al.54 https://github.com/computational- cell-analytics/micro-sam Matplotlib(v3.1.0) Hunter et al.55 https://matplotlib.org/stable/ FlowJo (v10.8.1) BD Biosciences N/A Bowtie2 N/A http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml RSEM N/A https://github.com/deweylab/RSEM STAR (v2.7.6a) N/A https://github.com/alexdobin/STAR R (v4.2.2) R Core Team https://www.r-project.org/ ggplot2 (v3.3.2) N/A https://github.com/tidyverse/ggplot2 Seurat (v4.3.0) N/A http://www.satijalab.org/seurat Python (v3.11) Python Software Foundation https://www.python.org/ Scanpy (v1.9.6) N/A https://scanpy.readthedocs.io/en/stable/ scVI (v1.4.1) N/A https://scvi-tools.org/ (Continued on next page) ll OPEN ACCESSArticle Developmental Cell 61, 1–17.e1–e8, July 8, 2026 e2 ..

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    RNA Sequencing:

    Article Title: Organoid modeling of lung branching morphogenesis and epithelial lineage specification.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-TTF1 Abcam Cat#ab76013; RRID:AB_1310784 Mouse monoclonal anti-Hop Antibody (E-1) Santa Cruz Biotechnology Cat#sc-398703; RRID:AB_2687966 Rabbit polyclonal anti-SFTPC Invitrogen Cat#PA5-102493; RRID: AB_2851895 Mouse monoclonal anti-RAGE R&D Cat#MAB1179; RRID:AB_2289349 Rabbit polyclonal anti-Sox9 Milipore Cat# AB5535; RRID: AB_2239761 Rabbit monoclonal anti-Sox2 Cell Signaling Technology Cat#23064; RRID: AB_2714146 Mouse polyclonal anti-ICAM-1 R&D Cat# AF796; RRID: AB_2248703 Hamster monoclonal anti-PDPN DSHB Cat#8.1.1; RRID: AB_531893 Rabbit monoclonal anti- PDGFR alpha Abcam Cat# ab203491; RRID: AB_2892065 Goat polyclonal anti-CD31 R&D Cat# AF3628; RRID: AB_2161028 Mouse monoclonal anti-acetylated Tubulin Sigma Cat# T7451;RRID: AB_609894 Mouse monoclonal anti-CC10(E-11) Santa Cruz Biotechnology Cat# sc365992; RRID: AB_10915481 Donkey polyclonal anti-rabbit IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat# A10042; RRID: AB_2534017 Donkey polyclonal anti-goat IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat# A-21447; RRID: AB_2535864 Donkey polyclonal anti-rat IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat# A78946; RRID: AB_2910653 Goat polyclonal anti- hamster IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat#A21451; RRID: AB_2535868 Donkey polyclonal anti-mouse IgG (H+L) (Alexa Fluor® 488) Thermo Fisher Cat#A21202; RRID: AB_141607 Donkey polyclonal anti-mouse IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat#A10037; RRID: AB_11180865 Donkey polyclonal anti-rabbit IgG (H+L) (Alexa Fluor® 488) Thermo Fisher Cat#A21206; RRID: AB_2535792 Goat polyclonal anti-rat IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat#A21247; RRID: AB_141778 Biological samples Mouse lung This paper N/A Chemicals, peptides, and recombinant proteins Dispase II Gibco Cat#17105-041 Matrigel Corning Cat#354234 DMEM/F12 Gibco Cat#11330032 N2 supplement Gibco Cat#17502-048 B27 Gibco Cat#17504-044 Penicilin-Streptomycin Gibco Cat#15140-122 CHIR99021 Targetmol Cat#T2310; FGF7 R&D Cat#251 FGF10 Peprotech Cat#100-26 BMP4 R&D Cat# 314-BP TGF-β1 Peprotech Cat#100-21 SHH R&D Cat# 464-SH Roxadustat Selleck Cat#S1007; Vitamin C Sigma Cat#49752 Monothioglycerol Sigma Cat#M6145 EPZ5676 Targetmol Cat#T3099; RA MCE Cat# HY-14649; EGF R&D Cat#2028-EG-200 Bleomycin sulfate Macklin Cat#B802467; Papain Worthington Cat#LS003126 BSA Miltenyi Biotec Cat#130-091-376 (Continued on next page) ll OPEN ACCESS Article e1 Developmental Cell 61, 1–17.e1–e8, July 8, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER TRIzol Reagent Invitrogen Cat#TR118 fetal bovine serum NTC Cat#SFBE Liberase TM Roche Cat#LIBTM-RO DNase I Worthington Biochemicals Cat#LS006343 ACK lysing buffer ThermoFisher Cat#A1049201 4% paraformaldehyde Coolaber Cat#SL1830 sucrose solutions Macklin Cat#:C17413261; OCT Sakura Cat#4583 TritonX-100 Yeasen Cat#20107ES20; PBS Cytiva Cat#SH30256.01 SPY-555-FastActTM Cytoskeleton Cat#SC205 DAPI Invitrogen Cat#D1306 Critical commercial assays Chromium Next GEM Single Cell 3′ GEM, Library & Gel Bead Kit v3.1 10X Genomics CatPN-1000121 VAHTS mRNA-seq v2 Library Prep Kit for Illumina Vazyme Cat#NR605 Masson‘s trichrome staining kit Solarbio Cat# G1346 Deposited data RNA sequencing data (raw and analyzed data) This paper GSE303739 scRNAseq sequencing data (raw and analyzed data) This paper GSE303739 Public scRNA-seq data Negretti et al.46 GSE165063 Public scRNA-seq data Zepp et al.47 GSE149563 Public scRNA-seq data Strunz et al.48 GSE141259 Public scRNA-seq data Angelidis et al.49 GSE124872 Experimental models: Organisms/strains Mouse: C57/6J Rosa26-mTmG The Jackson Laboratory RRID:IMSR_JAX007576 Mouse: CD-1®(ICR) IGS Guangdong Vital River Laboratory Animal Technology Co., Ltd. No.201 Mouse: C57BL/6J GemPharmatech Co., Ltd. No. N000013 Software and algorithms Napari(v0.5.4) N/A https://www.python.org/ Fiji Schneider et al.51 https://imagej.net/software/fiji/ Networkx(v3.4.2) Hagberg and Conway52 https://github.com/networkx/networkx Umap-learn(v0.5.7) McInnes et al.53 https://umap-learn.readthedocs. io/en/latest/ micro-SAM(v1.3.1) Archit et al.54 https://github.com/computational- cell-analytics/micro-sam Matplotlib(v3.1.0) Hunter et al.55 https://matplotlib.org/stable/ FlowJo (v10.8.1) BD Biosciences N/A Bowtie2 N/A http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml RSEM N/A https://github.com/deweylab/RSEM STAR (v2.7.6a) N/A https://github.com/alexdobin/STAR R (v4.2.2) R Core Team https://www.r-project.org/ ggplot2 (v3.3.2) N/A https://github.com/tidyverse/ggplot2 Seurat (v4.3.0) N/A http://www.satijalab.org/seurat Python (v3.11) Python Software Foundation https://www.python.org/ Scanpy (v1.9.6) N/A https://scanpy.readthedocs.io/en/stable/ scVI (v1.4.1) N/A https://scvi-tools.org/ (Continued on next page) ll OPEN ACCESSArticle Developmental Cell 61, 1–17.e1–e8, July 8, 2026 e2 ..

    Article Title: Urine IRF4/PENK/PXDN Methylation Signatures Enable Machine Learning-Driven Bladder Cancer Detection and Microenvironment Dissection.
    Article Snippet: .. To characterize the cell-type-specific expression patterns of IRF4, PENK, and PXDN in BC, we analyzed the publicly available single-cell RNA sequencing (scRNA-seq) dataset GSE267718 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi? acc=GSE267718), generated using the 10X Genomics platform. ..

    Article Title: Loss of the Y chromosome drives epigenetic and transcriptomic plasticity in lung adenocarcinoma
    Article Snippet: We sorted live, single-cell-gated CD45 + and CD45 neg cells using a FACSAria II cell sorter (BD Biosciences). .. The sorted CD45 + and CD45 neg cells derived from paired distal normal lung and lung adenocarcinoma samples were used for single-cell RNA sequencing analysis (10X Genomics, Single Cell 3′ Gene Expression v3.1). .. Approximately 5,000 cells per donor, derived from the same tissue type (distal normal or tumor) and sorted compartment (CD45 + and CD45 neg ), were combined (20,000 cells in total from 4 donors per well) and loaded in each well of the Chromium Next GEM Chip G (10X Genomics).

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Sequencing:

    Article Title: Organoid modeling of lung branching morphogenesis and epithelial lineage specification.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-TTF1 Abcam Cat#ab76013; RRID:AB_1310784 Mouse monoclonal anti-Hop Antibody (E-1) Santa Cruz Biotechnology Cat#sc-398703; RRID:AB_2687966 Rabbit polyclonal anti-SFTPC Invitrogen Cat#PA5-102493; RRID: AB_2851895 Mouse monoclonal anti-RAGE R&D Cat#MAB1179; RRID:AB_2289349 Rabbit polyclonal anti-Sox9 Milipore Cat# AB5535; RRID: AB_2239761 Rabbit monoclonal anti-Sox2 Cell Signaling Technology Cat#23064; RRID: AB_2714146 Mouse polyclonal anti-ICAM-1 R&D Cat# AF796; RRID: AB_2248703 Hamster monoclonal anti-PDPN DSHB Cat#8.1.1; RRID: AB_531893 Rabbit monoclonal anti- PDGFR alpha Abcam Cat# ab203491; RRID: AB_2892065 Goat polyclonal anti-CD31 R&D Cat# AF3628; RRID: AB_2161028 Mouse monoclonal anti-acetylated Tubulin Sigma Cat# T7451;RRID: AB_609894 Mouse monoclonal anti-CC10(E-11) Santa Cruz Biotechnology Cat# sc365992; RRID: AB_10915481 Donkey polyclonal anti-rabbit IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat# A10042; RRID: AB_2534017 Donkey polyclonal anti-goat IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat# A-21447; RRID: AB_2535864 Donkey polyclonal anti-rat IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat# A78946; RRID: AB_2910653 Goat polyclonal anti- hamster IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat#A21451; RRID: AB_2535868 Donkey polyclonal anti-mouse IgG (H+L) (Alexa Fluor® 488) Thermo Fisher Cat#A21202; RRID: AB_141607 Donkey polyclonal anti-mouse IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat#A10037; RRID: AB_11180865 Donkey polyclonal anti-rabbit IgG (H+L) (Alexa Fluor® 488) Thermo Fisher Cat#A21206; RRID: AB_2535792 Goat polyclonal anti-rat IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat#A21247; RRID: AB_141778 Biological samples Mouse lung This paper N/A Chemicals, peptides, and recombinant proteins Dispase II Gibco Cat#17105-041 Matrigel Corning Cat#354234 DMEM/F12 Gibco Cat#11330032 N2 supplement Gibco Cat#17502-048 B27 Gibco Cat#17504-044 Penicilin-Streptomycin Gibco Cat#15140-122 CHIR99021 Targetmol Cat#T2310; FGF7 R&D Cat#251 FGF10 Peprotech Cat#100-26 BMP4 R&D Cat# 314-BP TGF-β1 Peprotech Cat#100-21 SHH R&D Cat# 464-SH Roxadustat Selleck Cat#S1007; Vitamin C Sigma Cat#49752 Monothioglycerol Sigma Cat#M6145 EPZ5676 Targetmol Cat#T3099; RA MCE Cat# HY-14649; EGF R&D Cat#2028-EG-200 Bleomycin sulfate Macklin Cat#B802467; Papain Worthington Cat#LS003126 BSA Miltenyi Biotec Cat#130-091-376 (Continued on next page) ll OPEN ACCESS Article e1 Developmental Cell 61, 1–17.e1–e8, July 8, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER TRIzol Reagent Invitrogen Cat#TR118 fetal bovine serum NTC Cat#SFBE Liberase TM Roche Cat#LIBTM-RO DNase I Worthington Biochemicals Cat#LS006343 ACK lysing buffer ThermoFisher Cat#A1049201 4% paraformaldehyde Coolaber Cat#SL1830 sucrose solutions Macklin Cat#:C17413261; OCT Sakura Cat#4583 TritonX-100 Yeasen Cat#20107ES20; PBS Cytiva Cat#SH30256.01 SPY-555-FastActTM Cytoskeleton Cat#SC205 DAPI Invitrogen Cat#D1306 Critical commercial assays Chromium Next GEM Single Cell 3′ GEM, Library & Gel Bead Kit v3.1 10X Genomics CatPN-1000121 VAHTS mRNA-seq v2 Library Prep Kit for Illumina Vazyme Cat#NR605 Masson‘s trichrome staining kit Solarbio Cat# G1346 Deposited data RNA sequencing data (raw and analyzed data) This paper GSE303739 scRNAseq sequencing data (raw and analyzed data) This paper GSE303739 Public scRNA-seq data Negretti et al.46 GSE165063 Public scRNA-seq data Zepp et al.47 GSE149563 Public scRNA-seq data Strunz et al.48 GSE141259 Public scRNA-seq data Angelidis et al.49 GSE124872 Experimental models: Organisms/strains Mouse: C57/6J Rosa26-mTmG The Jackson Laboratory RRID:IMSR_JAX007576 Mouse: CD-1®(ICR) IGS Guangdong Vital River Laboratory Animal Technology Co., Ltd. No.201 Mouse: C57BL/6J GemPharmatech Co., Ltd. No. N000013 Software and algorithms Napari(v0.5.4) N/A https://www.python.org/ Fiji Schneider et al.51 https://imagej.net/software/fiji/ Networkx(v3.4.2) Hagberg and Conway52 https://github.com/networkx/networkx Umap-learn(v0.5.7) McInnes et al.53 https://umap-learn.readthedocs. io/en/latest/ micro-SAM(v1.3.1) Archit et al.54 https://github.com/computational- cell-analytics/micro-sam Matplotlib(v3.1.0) Hunter et al.55 https://matplotlib.org/stable/ FlowJo (v10.8.1) BD Biosciences N/A Bowtie2 N/A http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml RSEM N/A https://github.com/deweylab/RSEM STAR (v2.7.6a) N/A https://github.com/alexdobin/STAR R (v4.2.2) R Core Team https://www.r-project.org/ ggplot2 (v3.3.2) N/A https://github.com/tidyverse/ggplot2 Seurat (v4.3.0) N/A http://www.satijalab.org/seurat Python (v3.11) Python Software Foundation https://www.python.org/ Scanpy (v1.9.6) N/A https://scanpy.readthedocs.io/en/stable/ scVI (v1.4.1) N/A https://scvi-tools.org/ (Continued on next page) ll OPEN ACCESSArticle Developmental Cell 61, 1–17.e1–e8, July 8, 2026 e2 ..

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Software:

    Article Title: Organoid modeling of lung branching morphogenesis and epithelial lineage specification.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit monoclonal anti-TTF1 Abcam Cat#ab76013; RRID:AB_1310784 Mouse monoclonal anti-Hop Antibody (E-1) Santa Cruz Biotechnology Cat#sc-398703; RRID:AB_2687966 Rabbit polyclonal anti-SFTPC Invitrogen Cat#PA5-102493; RRID: AB_2851895 Mouse monoclonal anti-RAGE R&D Cat#MAB1179; RRID:AB_2289349 Rabbit polyclonal anti-Sox9 Milipore Cat# AB5535; RRID: AB_2239761 Rabbit monoclonal anti-Sox2 Cell Signaling Technology Cat#23064; RRID: AB_2714146 Mouse polyclonal anti-ICAM-1 R&D Cat# AF796; RRID: AB_2248703 Hamster monoclonal anti-PDPN DSHB Cat#8.1.1; RRID: AB_531893 Rabbit monoclonal anti- PDGFR alpha Abcam Cat# ab203491; RRID: AB_2892065 Goat polyclonal anti-CD31 R&D Cat# AF3628; RRID: AB_2161028 Mouse monoclonal anti-acetylated Tubulin Sigma Cat# T7451;RRID: AB_609894 Mouse monoclonal anti-CC10(E-11) Santa Cruz Biotechnology Cat# sc365992; RRID: AB_10915481 Donkey polyclonal anti-rabbit IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat# A10042; RRID: AB_2534017 Donkey polyclonal anti-goat IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat# A-21447; RRID: AB_2535864 Donkey polyclonal anti-rat IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat# A78946; RRID: AB_2910653 Goat polyclonal anti- hamster IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat#A21451; RRID: AB_2535868 Donkey polyclonal anti-mouse IgG (H+L) (Alexa Fluor® 488) Thermo Fisher Cat#A21202; RRID: AB_141607 Donkey polyclonal anti-mouse IgG (H+L) (Alexa Fluor® 568) Thermo Fisher Cat#A10037; RRID: AB_11180865 Donkey polyclonal anti-rabbit IgG (H+L) (Alexa Fluor® 488) Thermo Fisher Cat#A21206; RRID: AB_2535792 Goat polyclonal anti-rat IgG (H+L) (Alexa Fluor® 647) Thermo Fisher Cat#A21247; RRID: AB_141778 Biological samples Mouse lung This paper N/A Chemicals, peptides, and recombinant proteins Dispase II Gibco Cat#17105-041 Matrigel Corning Cat#354234 DMEM/F12 Gibco Cat#11330032 N2 supplement Gibco Cat#17502-048 B27 Gibco Cat#17504-044 Penicilin-Streptomycin Gibco Cat#15140-122 CHIR99021 Targetmol Cat#T2310; FGF7 R&D Cat#251 FGF10 Peprotech Cat#100-26 BMP4 R&D Cat# 314-BP TGF-β1 Peprotech Cat#100-21 SHH R&D Cat# 464-SH Roxadustat Selleck Cat#S1007; Vitamin C Sigma Cat#49752 Monothioglycerol Sigma Cat#M6145 EPZ5676 Targetmol Cat#T3099; RA MCE Cat# HY-14649; EGF R&D Cat#2028-EG-200 Bleomycin sulfate Macklin Cat#B802467; Papain Worthington Cat#LS003126 BSA Miltenyi Biotec Cat#130-091-376 (Continued on next page) ll OPEN ACCESS Article e1 Developmental Cell 61, 1–17.e1–e8, July 8, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER TRIzol Reagent Invitrogen Cat#TR118 fetal bovine serum NTC Cat#SFBE Liberase TM Roche Cat#LIBTM-RO DNase I Worthington Biochemicals Cat#LS006343 ACK lysing buffer ThermoFisher Cat#A1049201 4% paraformaldehyde Coolaber Cat#SL1830 sucrose solutions Macklin Cat#:C17413261; OCT Sakura Cat#4583 TritonX-100 Yeasen Cat#20107ES20; PBS Cytiva Cat#SH30256.01 SPY-555-FastActTM Cytoskeleton Cat#SC205 DAPI Invitrogen Cat#D1306 Critical commercial assays Chromium Next GEM Single Cell 3′ GEM, Library & Gel Bead Kit v3.1 10X Genomics CatPN-1000121 VAHTS mRNA-seq v2 Library Prep Kit for Illumina Vazyme Cat#NR605 Masson‘s trichrome staining kit Solarbio Cat# G1346 Deposited data RNA sequencing data (raw and analyzed data) This paper GSE303739 scRNAseq sequencing data (raw and analyzed data) This paper GSE303739 Public scRNA-seq data Negretti et al.46 GSE165063 Public scRNA-seq data Zepp et al.47 GSE149563 Public scRNA-seq data Strunz et al.48 GSE141259 Public scRNA-seq data Angelidis et al.49 GSE124872 Experimental models: Organisms/strains Mouse: C57/6J Rosa26-mTmG The Jackson Laboratory RRID:IMSR_JAX007576 Mouse: CD-1®(ICR) IGS Guangdong Vital River Laboratory Animal Technology Co., Ltd. No.201 Mouse: C57BL/6J GemPharmatech Co., Ltd. No. N000013 Software and algorithms Napari(v0.5.4) N/A https://www.python.org/ Fiji Schneider et al.51 https://imagej.net/software/fiji/ Networkx(v3.4.2) Hagberg and Conway52 https://github.com/networkx/networkx Umap-learn(v0.5.7) McInnes et al.53 https://umap-learn.readthedocs. io/en/latest/ micro-SAM(v1.3.1) Archit et al.54 https://github.com/computational- cell-analytics/micro-sam Matplotlib(v3.1.0) Hunter et al.55 https://matplotlib.org/stable/ FlowJo (v10.8.1) BD Biosciences N/A Bowtie2 N/A http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml RSEM N/A https://github.com/deweylab/RSEM STAR (v2.7.6a) N/A https://github.com/alexdobin/STAR R (v4.2.2) R Core Team https://www.r-project.org/ ggplot2 (v3.3.2) N/A https://github.com/tidyverse/ggplot2 Seurat (v4.3.0) N/A http://www.satijalab.org/seurat Python (v3.11) Python Software Foundation https://www.python.org/ Scanpy (v1.9.6) N/A https://scanpy.readthedocs.io/en/stable/ scVI (v1.4.1) N/A https://scvi-tools.org/ (Continued on next page) ll OPEN ACCESSArticle Developmental Cell 61, 1–17.e1–e8, July 8, 2026 e2 ..

    Expressing:

    Article Title: Urine IRF4/PENK/PXDN Methylation Signatures Enable Machine Learning-Driven Bladder Cancer Detection and Microenvironment Dissection.
    Article Snippet: .. To characterize the cell-type-specific expression patterns of IRF4, PENK, and PXDN in BC, we analyzed the publicly available single-cell RNA sequencing (scRNA-seq) dataset GSE267718 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi? acc=GSE267718), generated using the 10X Genomics platform. ..

    Generated:

    Article Title: Urine IRF4/PENK/PXDN Methylation Signatures Enable Machine Learning-Driven Bladder Cancer Detection and Microenvironment Dissection.
    Article Snippet: .. To characterize the cell-type-specific expression patterns of IRF4, PENK, and PXDN in BC, we analyzed the publicly available single-cell RNA sequencing (scRNA-seq) dataset GSE267718 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi? acc=GSE267718), generated using the 10X Genomics platform. ..

    Derivative Assay:

    Article Title: Loss of the Y chromosome drives epigenetic and transcriptomic plasticity in lung adenocarcinoma
    Article Snippet: We sorted live, single-cell-gated CD45 + and CD45 neg cells using a FACSAria II cell sorter (BD Biosciences). .. The sorted CD45 + and CD45 neg cells derived from paired distal normal lung and lung adenocarcinoma samples were used for single-cell RNA sequencing analysis (10X Genomics, Single Cell 3′ Gene Expression v3.1). .. Approximately 5,000 cells per donor, derived from the same tissue type (distal normal or tumor) and sorted compartment (CD45 + and CD45 neg ), were combined (20,000 cells in total from 4 donors per well) and loaded in each well of the Chromium Next GEM Chip G (10X Genomics).

    Gene Expression:

    Article Title: Loss of the Y chromosome drives epigenetic and transcriptomic plasticity in lung adenocarcinoma
    Article Snippet: We sorted live, single-cell-gated CD45 + and CD45 neg cells using a FACSAria II cell sorter (BD Biosciences). .. The sorted CD45 + and CD45 neg cells derived from paired distal normal lung and lung adenocarcinoma samples were used for single-cell RNA sequencing analysis (10X Genomics, Single Cell 3′ Gene Expression v3.1). .. Approximately 5,000 cells per donor, derived from the same tissue type (distal normal or tumor) and sorted compartment (CD45 + and CD45 neg ), were combined (20,000 cells in total from 4 donors per well) and loaded in each well of the Chromium Next GEM Chip G (10X Genomics).

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    other:

    Article Title: Identifying Predictors Of Long-Lasting Response To Mepolizumab In CRSwNP: Is The Disease-Modifying Role Secondary To Restored Anti-Viral Activity Or Enhanced Epithelial Regeneration?
    Article Snippet: Simultaneous profiling of gene expression and open chromatin from the same cell will be used to capture epigenetic modifications in identified cell clusters by RNA-seq combined with an assay for transposase-accessible chromatin (Chromium Single-Cell Multiome ATAC + Gene expression, 10X Genomics).

    Formalin-fixed Paraffin-Embedded:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Blocking Assay:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Amplification:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Polymer:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Labeling:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..

    Spatial Transcriptomics:

    Article Title: Hypoxia shapes both therapeutic response and resistance in metastatic clear cell renal cell carcinoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human ccRCC tumor frozen or FFPE sections MSKCC Mouse KVpR tumors This paper N/A Mouse C57BL/6J syngeneic ccRCC tumors This paper N/A Healthy adult tonsil tissue Mount Sinai Hospital Surgical Pathology N/A Chemicals, peptides, and recombinant proteins Lenvatinib (E7080) Selleckchem/MedChemExpress Cat #S1164/HY-10981 BLZ945 (CSF1Ri; Soluletinib) Selleckchem/MedChemExpress Cat #S7725/HY-12768 Tamoxifen citrate chow, 400ppm Envigo N/A, discontinued Tamoxifen Sigma-Aldrich Cat #T5648 human recombinant M-CSF STEMCELL technologies Cat # 78057 Cobalt(II) chloride hexhydrate Sigma-Aldrich Cat #C8661 Hypoxyprobe HypoxyprobeTM N/A DAPI BD Pharmingen Cat # 564907 Calcein AM Invitrogen Cat #C3100MP Ack Lysing buffer Gibco Cat # A10492-01 Liberase TM Roche Cat # 5401119001 Collagenase Type II STEMCELL Technologies Cat # 07419 Percoll Cytiva Cat # 17-0891-01 Zombie NIR dye Biolegend Cat # 77184 TruStain FcX (anti-mouse CD16/32) Biolegend Cat # 101320 UltraComp eBeads compensation beads Invitrogen Cat # 01-2222-42 phorbol 12-myristate 13-acetate Sigma-Aldrich Cat #P8139 Ionomycin calcium salt Sigma-Aldrich Cat #I0634 Golgi-Stop BD Biosciences Cat # 51-2092KZ ImmunoCult SF macrophage medium STEMCELL technologies Cat # 10961 Sodium Carboxymethyl Cellulose Sigma-Aldrich Cat # 419273 Corn oil MedChem Express Cat # HY-Y1888 Tween 80 Sigma-Aldrich Cat #P8074 DNAase I Sigma-Aldrich Cat # DN25 Cryostor 10 Biolife Solutions Cat # 210102 Advanced DMEM/F-12 (Dulbecco’s Modified Eagle Medium/Ham’s F-12) Gibco Cat # 12634028 Prostaglandin E1 Sigma-Aldrich Cat #P7527 Triiodothyronine Sigma-Aldrich Cat #T5516 Hydrocortisone Sigma-Aldrich Cat #H0396 Epidermal growth factor Invitrogen Cat # 13247051 GlutaMAX Thermo Fisher Scientific Cat # 3505061 Penicillin-Streptomycin Thermo Scientific Cat # 15140122 Fetal Bovine Serum Fisherbrand Cat # FB12999102 Cytoseal XYL Thermo Scientific Cat # 8312-4 TRIzol reagent ThermoFisher Cat # 15596018 Bovine Serum Albumin Sigma-Aldrich Cat # A3059-50G Horse Serum Sigma-Aldrich Cat #H0146-5ML Cell-ID Intercalator: Iridium 500 uM Standard Biotools Cat # 201192B Antibody Stabilizer, PBS base Candor Biosciences Cat # 131-125(BC) Critical commercial assays EasySep human monocyte enrichment kit without CD16 depletion STEMCELL technologies Cat # 19058 Human Osteopontin Quantikine ELISA kit R&D systems Cat #D0ST00 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–19.e1–e15, July 13, 2026 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tumor Dissociation Kit, human Miltenyi Cat # 130-095-929 Tumor Dissociation Kit, mouse Miltenyi Cat # 130-096-730 Chromium Next GEM Single Cell 5′ mRNA V2 Kit 10X Genomics PN-1000263 Library Construction Kit 10X Genomics PN-1000190 Chromium Next GEM Chip K Single Cell Kit 10X Genomics PN-1000287 Dual Index Kit TT Set A 10X Genomics PN-1000215 Visium Spatial for FFPE Gene Expression Kit, Human Transcriptome 10X Genomics PN-1000336 miRNeasy Micro kit Qiagen Cat # 217084 miRNeasy Mini kit Qiagen Cat # 217004 RNeasy FFPE Kit Qiagen Cat # 73504 MagMAX FFPE DNA/RNA Ultra Kit Thermofisher Cat # A31881 Foxp3/Transcription Factor Staining Buffer Kit Cytek Biosciences Cat # TNB-06070KIT TruSeq Stranded Total RNA LT Kit Illumina Cat # RS-122-1202 AllPrep DNA/RNA FFPE Kit Qiagen Cat # 80234 Citrate-Based Antigen Unmasking Solution Vector Laboratories Cat # H-3300-250 BLOXALL Blocking Solution Vector Laboratories Cat # SP-6000-100 ImmPRESS Excel Amplified anti-Rabbit IgG HRP Polymer Staining Kit Vector Laboratories Cat # MP-7601-50 VECTASTAIN Elite ABC-HRP Kit Vector Laboratories Cat # PK-6101 MaxparTM X8 Multi-Metal Labeling Kit40 Rxn Standard Biotools Cat # 201300 Deposited data Raw mouse scRNA-seq data This paper GEO: GSE293450 Raw and processed human MSKCC RWD bulk RNA-seq data This paper GEO: GSE293952 Raw human scRNA-seq data This paper GEO: GSE294109 Raw human Visium spatial transcriptomics data This paper GEO: GSE294006 Experimental models: Cell lines LVRCC67 Rappold, Vuong et al.43 2022 N/A LVRCC67-LM2 This paper N/A LVRCC88 This paper N/A LVRCC88-M1 This paper N/A Experimental models: Organisms/strains Mouse: KspCreERT2;Vhlf/f;Trp53f/f;Rb1f/f (KVpR) Harlander et al.28 2017 N/A Mouse: C57BL/6J Jackson Laboratories Strain # 000664 Oligonucleotides Vhl sgRNA targeting sequence: CCCGGTGGTAAGATCGGGTA This paper N/A Trp53 sgRNA targeting sequence: ACCCTGTCACCGAGACCCC This paper N/A Rb1 sgRNA targeting sequence: TGCGCGGGGTCGTCCTCCCG This paper N/A Primer: Vhl sgRNA cut site forward: GACCCGTTCCAATAATGCCC This paper N/A Primer: Vhl sgRNA cut site reverse: GCAAACCTCTAAGCTCGGTG This paper N/A (Continued on next page) ll OPEN ACCESS Article e5 Cancer Cell 44, 1–19.e1–e15, July 13, 2026 ..



    Similar Products

    single cell rna sequencing  (MedChemExpress)
    95
    MedChemExpress single cell rna sequencing
    Single Cell Rna Sequencing, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-+cell+rna+sequencing/Histone+H3/pm42310760-485-30-72
    Average 95 stars, based on 1 article reviews
    single cell rna sequencing - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    single cell rna sequencing  (10X Genomics)
    86
    10X Genomics single cell rna sequencing
    Data summary. (A) Schematic of sample and data processing. Numbers denote the number of samples; amplification of TP53 loci enabled targeted genotyping of known TP53 mutation sites (Supporting Information S2: Methods, ). Image created with BioRender. (B) ERCC6L2 disease (ED) and Shwachman–Diamond (SDS) blood and bone marrow (BM) samples included in this study, depicted at their different stages of disease. Numbers denote the number of samples obtained from 10 ED and 5 SDS patients for BM, and from 12 ED and 5 SDS patients for blood. Colors depict the type of samples (BM or blood). Samples with “no TP53 ” denote samples without somatic TP53 mutations, and other samples depict cases with 1–4 TP53 mutations. (C) Detected cell types of our <t>integrated</t> <t>single‐cell</t> transcriptomics data. (D) TP53 mutation status of cells. Numbers denote the number of cells that were identified as TP53 ‐mutated or TP53 wild‐type. AML, acute myeloid leukemia; BMF, bone marrow failure; HC, healthy control; HSC, hematopoietic stem cell; LMP, lymphomyeloid progenitor; MDS, myelodysplastic syndrome; MPP, multipotent progenitor cell; VAF, variant allele fraction.
    Single Cell Rna Sequencing, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-+cell+rna+sequencing/pmc13270343-36-5-10
    Average 86 stars, based on 1 article reviews
    single cell rna sequencing - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    single cell rna sequencing dataset scp259  (Broad Clinical Labs)
    96
    Broad Clinical Labs single cell rna sequencing dataset scp259
    Data summary. (A) Schematic of sample and data processing. Numbers denote the number of samples; amplification of TP53 loci enabled targeted genotyping of known TP53 mutation sites (Supporting Information S2: Methods, ). Image created with BioRender. (B) ERCC6L2 disease (ED) and Shwachman–Diamond (SDS) blood and bone marrow (BM) samples included in this study, depicted at their different stages of disease. Numbers denote the number of samples obtained from 10 ED and 5 SDS patients for BM, and from 12 ED and 5 SDS patients for blood. Colors depict the type of samples (BM or blood). Samples with “no TP53 ” denote samples without somatic TP53 mutations, and other samples depict cases with 1–4 TP53 mutations. (C) Detected cell types of our <t>integrated</t> <t>single‐cell</t> transcriptomics data. (D) TP53 mutation status of cells. Numbers denote the number of cells that were identified as TP53 ‐mutated or TP53 wild‐type. AML, acute myeloid leukemia; BMF, bone marrow failure; HC, healthy control; HSC, hematopoietic stem cell; LMP, lymphomyeloid progenitor; MDS, myelodysplastic syndrome; MPP, multipotent progenitor cell; VAF, variant allele fraction.
    Single Cell Rna Sequencing Dataset Scp259, supplied by Broad Clinical Labs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-+cell+rna+sequencing/RNA+Sequencing/pmc13022602-120-24-21
    Average 96 stars, based on 1 article reviews
    single cell rna sequencing dataset scp259 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    single cell rna sequencing data  (Human Protein Atlas)
    86
    Human Protein Atlas single cell rna sequencing data
    Data summary. (A) Schematic of sample and data processing. Numbers denote the number of samples; amplification of TP53 loci enabled targeted genotyping of known TP53 mutation sites (Supporting Information S2: Methods, ). Image created with BioRender. (B) ERCC6L2 disease (ED) and Shwachman–Diamond (SDS) blood and bone marrow (BM) samples included in this study, depicted at their different stages of disease. Numbers denote the number of samples obtained from 10 ED and 5 SDS patients for BM, and from 12 ED and 5 SDS patients for blood. Colors depict the type of samples (BM or blood). Samples with “no TP53 ” denote samples without somatic TP53 mutations, and other samples depict cases with 1–4 TP53 mutations. (C) Detected cell types of our <t>integrated</t> <t>single‐cell</t> transcriptomics data. (D) TP53 mutation status of cells. Numbers denote the number of cells that were identified as TP53 ‐mutated or TP53 wild‐type. AML, acute myeloid leukemia; BMF, bone marrow failure; HC, healthy control; HSC, hematopoietic stem cell; LMP, lymphomyeloid progenitor; MDS, myelodysplastic syndrome; MPP, multipotent progenitor cell; VAF, variant allele fraction.
    Single Cell Rna Sequencing Data, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-+cell+rna+sequencing/data+rna+seq/pm42297195-165-0-12
    Average 86 stars, based on 1 article reviews
    single cell rna sequencing data - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    single cell rna sequencing scrna seq dataset gse267718  (10X Genomics)
    86
    10X Genomics single cell rna sequencing scrna seq dataset gse267718
    Data summary. (A) Schematic of sample and data processing. Numbers denote the number of samples; amplification of TP53 loci enabled targeted genotyping of known TP53 mutation sites (Supporting Information S2: Methods, ). Image created with BioRender. (B) ERCC6L2 disease (ED) and Shwachman–Diamond (SDS) blood and bone marrow (BM) samples included in this study, depicted at their different stages of disease. Numbers denote the number of samples obtained from 10 ED and 5 SDS patients for BM, and from 12 ED and 5 SDS patients for blood. Colors depict the type of samples (BM or blood). Samples with “no TP53 ” denote samples without somatic TP53 mutations, and other samples depict cases with 1–4 TP53 mutations. (C) Detected cell types of our <t>integrated</t> <t>single‐cell</t> transcriptomics data. (D) TP53 mutation status of cells. Numbers denote the number of cells that were identified as TP53 ‐mutated or TP53 wild‐type. AML, acute myeloid leukemia; BMF, bone marrow failure; HC, healthy control; HSC, hematopoietic stem cell; LMP, lymphomyeloid progenitor; MDS, myelodysplastic syndrome; MPP, multipotent progenitor cell; VAF, variant allele fraction.
    Single Cell Rna Sequencing Scrna Seq Dataset Gse267718, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-+cell+rna+sequencing/pm42276585-115-18-29
    Average 86 stars, based on 1 article reviews
    single cell rna sequencing scrna seq dataset gse267718 - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    single cell rna sequencing scrna seq  (Macrogen)
    86
    Macrogen single cell rna sequencing scrna seq
    Data summary. (A) Schematic of sample and data processing. Numbers denote the number of samples; amplification of TP53 loci enabled targeted genotyping of known TP53 mutation sites (Supporting Information S2: Methods, ). Image created with BioRender. (B) ERCC6L2 disease (ED) and Shwachman–Diamond (SDS) blood and bone marrow (BM) samples included in this study, depicted at their different stages of disease. Numbers denote the number of samples obtained from 10 ED and 5 SDS patients for BM, and from 12 ED and 5 SDS patients for blood. Colors depict the type of samples (BM or blood). Samples with “no TP53 ” denote samples without somatic TP53 mutations, and other samples depict cases with 1–4 TP53 mutations. (C) Detected cell types of our <t>integrated</t> <t>single‐cell</t> transcriptomics data. (D) TP53 mutation status of cells. Numbers denote the number of cells that were identified as TP53 ‐mutated or TP53 wild‐type. AML, acute myeloid leukemia; BMF, bone marrow failure; HC, healthy control; HSC, hematopoietic stem cell; LMP, lymphomyeloid progenitor; MDS, myelodysplastic syndrome; MPP, multipotent progenitor cell; VAF, variant allele fraction.
    Single Cell Rna Sequencing Scrna Seq, supplied by Macrogen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-+cell+rna+sequencing/rna+seq/pm42266095-96-0-7
    Average 86 stars, based on 1 article reviews
    single cell rna sequencing scrna seq - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    single cell rna sequencing  (Singleron Biotechnologies)
    86
    Singleron Biotechnologies single cell rna sequencing
    Identification of overlapping genes among drug targets, disease-related genes, and GEO differentially expressed genes ( MPO and ITGB3 ) <t>and</t> <t>Single-Cell</t> Analysis. ( A ) The “drug–active ingredient–target gene–pathway–disease” network, illustrating the interactions among Coicis Semen , its active ingredients, candidate target genes, enriched signaling pathways, and osteomyelitis. ( B ) Venn diagram of the predicted target genes of Coicis Semen , osteomyelitis-related genes, and differentially expressed genes, with 3 overlapping common genes identified. ( C ) UMAP clustering plot of single-cell <t>RNA</t> <t>sequencing</t> data from bone marrow tissues of mice with S. aureus -induced osteomyelitis, identifying major cell populations including B cells, endothelial cells, macrophages, mast cells, monocytes, neutrophils, and T cells. ( D ) FeaturePlot showing the characteristic expression of Mpo and Itgb3 across different cell populations. ( E ) Expression heatmap of marker genes across different cell populations, applied for cell type annotation. ( F ) Violin plots displaying the expression distribution of Mpo and Itgb3 across different cell populations. Mpo was mainly enriched in neutrophils, while Itgb3 was primarily expressed in monocytes and also detected in partial macrophages.
    Single Cell Rna Sequencing, supplied by Singleron Biotechnologies, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-+cell+rna+sequencing/cell+gexscope+kit+library+rna+single/pmc13264989-44-0-6
    Average 86 stars, based on 1 article reviews
    single cell rna sequencing - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    droplet based 10x genomics single cell 2 rna sequencing  (10X Genomics)
    86
    10X Genomics droplet based 10x genomics single cell 2 rna sequencing
    Identification of overlapping genes among drug targets, disease-related genes, and GEO differentially expressed genes ( MPO and ITGB3 ) <t>and</t> <t>Single-Cell</t> Analysis. ( A ) The “drug–active ingredient–target gene–pathway–disease” network, illustrating the interactions among Coicis Semen , its active ingredients, candidate target genes, enriched signaling pathways, and osteomyelitis. ( B ) Venn diagram of the predicted target genes of Coicis Semen , osteomyelitis-related genes, and differentially expressed genes, with 3 overlapping common genes identified. ( C ) UMAP clustering plot of single-cell <t>RNA</t> <t>sequencing</t> data from bone marrow tissues of mice with S. aureus -induced osteomyelitis, identifying major cell populations including B cells, endothelial cells, macrophages, mast cells, monocytes, neutrophils, and T cells. ( D ) FeaturePlot showing the characteristic expression of Mpo and Itgb3 across different cell populations. ( E ) Expression heatmap of marker genes across different cell populations, applied for cell type annotation. ( F ) Violin plots displaying the expression distribution of Mpo and Itgb3 across different cell populations. Mpo was mainly enriched in neutrophils, while Itgb3 was primarily expressed in monocytes and also detected in partial macrophages.
    Droplet Based 10x Genomics Single Cell 2 Rna Sequencing, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-+cell+rna+sequencing/pm42269093-58-13-14
    Average 86 stars, based on 1 article reviews
    droplet based 10x genomics single cell 2 rna sequencing - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    single cell rna sequencing analysis  (10X Genomics)
    86
    10X Genomics single cell rna sequencing analysis
    (A) Experimental overview illustrating the generation of <t>isogenic</t> <t>single-cell</t> LOY and ROY clones from parental A549 cells and the multi-omic analysis of clones and patients. (B) Representative WGS profiles of ROY (top, orange) and LOY (bottom, blue) clones. Left: zoomed-in view of the Y chromosome. Right: genome-wide Circos plots (right). (C) Volcano plot of differentially expressed genes between LOY (n=4) and ROY (n=4) clones (Y-linked genes excluded). X-axis: log2 fold change; y-axis: -log 10 (p-value). Blue: significantly upregulated genes in LOY; orange: downregulated in LOY. (D) Dot plot showing the top 6 Hallmark gene sets with FDR<0.25 from preranked GSEA of <t>RNA-seq</t> data. X-axis: normalized enrichment score (NES); y-axis: gene sets. Dot size indicates gene count; color represents -log 10 (FDR). (E) Heatmap of lead genes contributing to the EMT gene set enrichment. TPM values are z-scored across clones. (F) Dot plot of Hallmark gene sets from GSEA of full proteome data at 70% confluency (left) and 100% confluency (right). X-axis: normalized enrichment score (NES); y-axis: gene sets. Dot size indicates protein count; color represents -log 10 (FDR). ( G ) Confocal microscopy images of clones stained for N-cadherin (green). Nuclei are counterstained with DAPI (4′,6-diamidino-2-phenylindole, blue). Scale bar 20 µm (H) . Flow cytometry histograms of CD90 expression for LOY (blue) and ROY (orange) clones, with isotype controls shown. (I) Dot plot of top 10 Hallmark gene sets from preranked GSEA of TCGA LUAD samples (LOY vs. ROY). (J) Dot plot the top 8 positively enriched Hallmark gene sets from GSEA of the LuCA single-cell dataset (LOY vs. ROY tumor cells).
    Single Cell Rna Sequencing Analysis, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-+cell+rna+sequencing/bio_rxiv__64898__2026__06__02__729627-237-21-25
    Average 86 stars, based on 1 article reviews
    single cell rna sequencing analysis - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    single cell rna sequencing scrna seq datasets  (10X Genomics)
    86
    10X Genomics single cell rna sequencing scrna seq datasets
    <t>Single-cell</t> <t>transcriptomic</t> analysis of liver fibrosis. (A) Quality control metrics before cell filtering, including the distribution of gene counts <t>(nFeature_RNA),</t> UMI counts (nCount_RNA), and the percentages of mitochondrial and hemoglobin genes across samples. (B) Cell clustering of liver fibrosis samples. (C) Cell-type annotation of single-cell <t>RNA-seq</t> data. (D) Cell cycle analysis of single-cell transcriptomic data. (E) Proportional changes of different cell types between normal and fibrotic groups. (F) Expression distribution of Acot9, Aldh1b1, and Pck2 across different cell types.
    Single Cell Rna Sequencing Scrna Seq Datasets, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-+cell+rna+sequencing/pmc13253275-65-0-16
    Average 86 stars, based on 1 article reviews
    single cell rna sequencing scrna seq datasets - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    Data summary. (A) Schematic of sample and data processing. Numbers denote the number of samples; amplification of TP53 loci enabled targeted genotyping of known TP53 mutation sites (Supporting Information S2: Methods, ). Image created with BioRender. (B) ERCC6L2 disease (ED) and Shwachman–Diamond (SDS) blood and bone marrow (BM) samples included in this study, depicted at their different stages of disease. Numbers denote the number of samples obtained from 10 ED and 5 SDS patients for BM, and from 12 ED and 5 SDS patients for blood. Colors depict the type of samples (BM or blood). Samples with “no TP53 ” denote samples without somatic TP53 mutations, and other samples depict cases with 1–4 TP53 mutations. (C) Detected cell types of our integrated single‐cell transcriptomics data. (D) TP53 mutation status of cells. Numbers denote the number of cells that were identified as TP53 ‐mutated or TP53 wild‐type. AML, acute myeloid leukemia; BMF, bone marrow failure; HC, healthy control; HSC, hematopoietic stem cell; LMP, lymphomyeloid progenitor; MDS, myelodysplastic syndrome; MPP, multipotent progenitor cell; VAF, variant allele fraction.

    Journal: HemaSphere

    Article Title: Distinct stem cell identities converge into shared erythroid stress in ERCC6L2 disease and Shwachman–Diamond syndrome

    doi: 10.1002/hem3.70374

    Figure Lengend Snippet: Data summary. (A) Schematic of sample and data processing. Numbers denote the number of samples; amplification of TP53 loci enabled targeted genotyping of known TP53 mutation sites (Supporting Information S2: Methods, ). Image created with BioRender. (B) ERCC6L2 disease (ED) and Shwachman–Diamond (SDS) blood and bone marrow (BM) samples included in this study, depicted at their different stages of disease. Numbers denote the number of samples obtained from 10 ED and 5 SDS patients for BM, and from 12 ED and 5 SDS patients for blood. Colors depict the type of samples (BM or blood). Samples with “no TP53 ” denote samples without somatic TP53 mutations, and other samples depict cases with 1–4 TP53 mutations. (C) Detected cell types of our integrated single‐cell transcriptomics data. (D) TP53 mutation status of cells. Numbers denote the number of cells that were identified as TP53 ‐mutated or TP53 wild‐type. AML, acute myeloid leukemia; BMF, bone marrow failure; HC, healthy control; HSC, hematopoietic stem cell; LMP, lymphomyeloid progenitor; MDS, myelodysplastic syndrome; MPP, multipotent progenitor cell; VAF, variant allele fraction.

    Article Snippet: For BM samples, we applied single‐cell RNA sequencing (scRNA‐seq, 3′ 10X Genomics) and integrated the data using single‐cell variational inference (scVI).

    Techniques: Amplification, Mutagenesis, Single-cell Transcriptomics, Control, Variant Assay

    Transcriptional landscape of bone marrow (BM) erythroid progenitors, peripheral blood cells, and fibroblasts in ERCC6L2 disease (ED) compared to Shwachman–Diamond syndrome (SDS). (A) Comparison of ED bone marrow failure (BMF) and SDS BMF differentially expressed genes (DEGs) showing log 2 fold changes (log 2 FC) of expression in ED BMF ( n samples = 12) and SDS BMF ( n samples = 4) against healthy controls ( n samples = 63) in BM hematopoietic stem cell (HSC) and multipotent progenitor cell (MPP) ( n cells = 370; 30; 27 for healthy control, ED BMF and SDS BMF, respectively), erythroid–myeloid progenitor (EMP) ( n cells = 1579; 140; 62), early erythroid progenitor (EEP) ( n cells = 11,826; 777; 232), and late erythroid progenitor (LEP) ( n cells = 2422; 858; 385). Genes falling close to the diagonal exhibit similar magnitude and direction of differential expression in both diseases, whereas genes deviating from the diagonal reflect differences in the extent of dysregulation between ED and SDS. Blue points indicate genes concordantly regulated in both conditions (upregulated or downregulated relative to controls), while orange points indicate genes regulated in opposite directions between ED and SDS. (B) Top 10 non‐redundant pathways across cell types for BM. Enriched pathways were sorted by FDR‐adjusted P‐values P adj . Redundant pathways (pathways containing DEGs of which more than half of the DEGs are members of a pathway with a smaller P adj ) and pathways not enriched for one of the cell types were filtered out. From the remaining pathways, the top 10 based on the smallest P adj across cell types were plotted. (C) Hematopoietic‐ and erythroid‐specific pathway enrichment in ED BMF and SDS BMF. Reactome pathway enrichment analysis focusing on pathways related to hematopoiesis and erythropoiesis in bulk blood RNA‐seq data. Pathways were selected based on lineage relevance and the presence of multiple significantly differentially expressed genes, thereby excluding pathways driven by single‐gene effects. Shown are pathways significantly enriched in ED BMF and SDS BMF compared to healthy controls, with adjusted P‐values indicated. (D) Comparison of ED BMF and SDS BMF DEGs showing log 2 FC of expression in ED BMF ( n = 28) and SDS BMF ( n = 7) against healthy controls ( n = 11) in blood samples. (E) Top five enriched pathways in ED BMF and SDS BMF compared to healthy controls in blood samples. (F) Comparison of ED and SDS DEGs showing log 2 FC of expression in ED ( n = 74) and SDS ( n = 55) against healthy controls ( n = 68) in fibroblast samples. (G) Top five enriched pathways on ED and SDS compared to healthy controls in fibroblasts. FDR, false discovery rate; HC, healthy control; R , Pearson correlation coefficient. DEGs, genes with P adj < 0.05 in the differential expression (DE) analysis results. Enriched pathways, pathways with P adj < 0.05 in pathway analysis results. DEGs were obtained using MAST for BM in (A) and using DESeq2 for blood in (D) and fibroblast (F) and enriched pathways were obtained using enrichR for BM (B, C) , blood (E) , and fibroblasts (G) .

    Journal: HemaSphere

    Article Title: Distinct stem cell identities converge into shared erythroid stress in ERCC6L2 disease and Shwachman–Diamond syndrome

    doi: 10.1002/hem3.70374

    Figure Lengend Snippet: Transcriptional landscape of bone marrow (BM) erythroid progenitors, peripheral blood cells, and fibroblasts in ERCC6L2 disease (ED) compared to Shwachman–Diamond syndrome (SDS). (A) Comparison of ED bone marrow failure (BMF) and SDS BMF differentially expressed genes (DEGs) showing log 2 fold changes (log 2 FC) of expression in ED BMF ( n samples = 12) and SDS BMF ( n samples = 4) against healthy controls ( n samples = 63) in BM hematopoietic stem cell (HSC) and multipotent progenitor cell (MPP) ( n cells = 370; 30; 27 for healthy control, ED BMF and SDS BMF, respectively), erythroid–myeloid progenitor (EMP) ( n cells = 1579; 140; 62), early erythroid progenitor (EEP) ( n cells = 11,826; 777; 232), and late erythroid progenitor (LEP) ( n cells = 2422; 858; 385). Genes falling close to the diagonal exhibit similar magnitude and direction of differential expression in both diseases, whereas genes deviating from the diagonal reflect differences in the extent of dysregulation between ED and SDS. Blue points indicate genes concordantly regulated in both conditions (upregulated or downregulated relative to controls), while orange points indicate genes regulated in opposite directions between ED and SDS. (B) Top 10 non‐redundant pathways across cell types for BM. Enriched pathways were sorted by FDR‐adjusted P‐values P adj . Redundant pathways (pathways containing DEGs of which more than half of the DEGs are members of a pathway with a smaller P adj ) and pathways not enriched for one of the cell types were filtered out. From the remaining pathways, the top 10 based on the smallest P adj across cell types were plotted. (C) Hematopoietic‐ and erythroid‐specific pathway enrichment in ED BMF and SDS BMF. Reactome pathway enrichment analysis focusing on pathways related to hematopoiesis and erythropoiesis in bulk blood RNA‐seq data. Pathways were selected based on lineage relevance and the presence of multiple significantly differentially expressed genes, thereby excluding pathways driven by single‐gene effects. Shown are pathways significantly enriched in ED BMF and SDS BMF compared to healthy controls, with adjusted P‐values indicated. (D) Comparison of ED BMF and SDS BMF DEGs showing log 2 FC of expression in ED BMF ( n = 28) and SDS BMF ( n = 7) against healthy controls ( n = 11) in blood samples. (E) Top five enriched pathways in ED BMF and SDS BMF compared to healthy controls in blood samples. (F) Comparison of ED and SDS DEGs showing log 2 FC of expression in ED ( n = 74) and SDS ( n = 55) against healthy controls ( n = 68) in fibroblast samples. (G) Top five enriched pathways on ED and SDS compared to healthy controls in fibroblasts. FDR, false discovery rate; HC, healthy control; R , Pearson correlation coefficient. DEGs, genes with P adj < 0.05 in the differential expression (DE) analysis results. Enriched pathways, pathways with P adj < 0.05 in pathway analysis results. DEGs were obtained using MAST for BM in (A) and using DESeq2 for blood in (D) and fibroblast (F) and enriched pathways were obtained using enrichR for BM (B, C) , blood (E) , and fibroblasts (G) .

    Article Snippet: For BM samples, we applied single‐cell RNA sequencing (scRNA‐seq, 3′ 10X Genomics) and integrated the data using single‐cell variational inference (scVI).

    Techniques: Comparison, Expressing, Control, Quantitative Proteomics, RNA Sequencing

    Identification of overlapping genes among drug targets, disease-related genes, and GEO differentially expressed genes ( MPO and ITGB3 ) and Single-Cell Analysis. ( A ) The “drug–active ingredient–target gene–pathway–disease” network, illustrating the interactions among Coicis Semen , its active ingredients, candidate target genes, enriched signaling pathways, and osteomyelitis. ( B ) Venn diagram of the predicted target genes of Coicis Semen , osteomyelitis-related genes, and differentially expressed genes, with 3 overlapping common genes identified. ( C ) UMAP clustering plot of single-cell RNA sequencing data from bone marrow tissues of mice with S. aureus -induced osteomyelitis, identifying major cell populations including B cells, endothelial cells, macrophages, mast cells, monocytes, neutrophils, and T cells. ( D ) FeaturePlot showing the characteristic expression of Mpo and Itgb3 across different cell populations. ( E ) Expression heatmap of marker genes across different cell populations, applied for cell type annotation. ( F ) Violin plots displaying the expression distribution of Mpo and Itgb3 across different cell populations. Mpo was mainly enriched in neutrophils, while Itgb3 was primarily expressed in monocytes and also detected in partial macrophages.

    Journal: Infection and Drug Resistance

    Article Title: The Role of Coicis Semen in Staphylococcus aureus -Induced Osteomyelitis: Bioinformatics Integrated with Experimental Validation

    doi: 10.2147/IDR.S596872

    Figure Lengend Snippet: Identification of overlapping genes among drug targets, disease-related genes, and GEO differentially expressed genes ( MPO and ITGB3 ) and Single-Cell Analysis. ( A ) The “drug–active ingredient–target gene–pathway–disease” network, illustrating the interactions among Coicis Semen , its active ingredients, candidate target genes, enriched signaling pathways, and osteomyelitis. ( B ) Venn diagram of the predicted target genes of Coicis Semen , osteomyelitis-related genes, and differentially expressed genes, with 3 overlapping common genes identified. ( C ) UMAP clustering plot of single-cell RNA sequencing data from bone marrow tissues of mice with S. aureus -induced osteomyelitis, identifying major cell populations including B cells, endothelial cells, macrophages, mast cells, monocytes, neutrophils, and T cells. ( D ) FeaturePlot showing the characteristic expression of Mpo and Itgb3 across different cell populations. ( E ) Expression heatmap of marker genes across different cell populations, applied for cell type annotation. ( F ) Violin plots displaying the expression distribution of Mpo and Itgb3 across different cell populations. Mpo was mainly enriched in neutrophils, while Itgb3 was primarily expressed in monocytes and also detected in partial macrophages.

    Article Snippet: Single-cell RNA sequencing was performed by Singleron Biotechnologies Co., Ltd.

    Techniques: Single-cell Analysis, Protein-Protein interactions, Single Cell, RNA Sequencing, Expressing, Marker

    (A) Experimental overview illustrating the generation of isogenic single-cell LOY and ROY clones from parental A549 cells and the multi-omic analysis of clones and patients. (B) Representative WGS profiles of ROY (top, orange) and LOY (bottom, blue) clones. Left: zoomed-in view of the Y chromosome. Right: genome-wide Circos plots (right). (C) Volcano plot of differentially expressed genes between LOY (n=4) and ROY (n=4) clones (Y-linked genes excluded). X-axis: log2 fold change; y-axis: -log 10 (p-value). Blue: significantly upregulated genes in LOY; orange: downregulated in LOY. (D) Dot plot showing the top 6 Hallmark gene sets with FDR<0.25 from preranked GSEA of RNA-seq data. X-axis: normalized enrichment score (NES); y-axis: gene sets. Dot size indicates gene count; color represents -log 10 (FDR). (E) Heatmap of lead genes contributing to the EMT gene set enrichment. TPM values are z-scored across clones. (F) Dot plot of Hallmark gene sets from GSEA of full proteome data at 70% confluency (left) and 100% confluency (right). X-axis: normalized enrichment score (NES); y-axis: gene sets. Dot size indicates protein count; color represents -log 10 (FDR). ( G ) Confocal microscopy images of clones stained for N-cadherin (green). Nuclei are counterstained with DAPI (4′,6-diamidino-2-phenylindole, blue). Scale bar 20 µm (H) . Flow cytometry histograms of CD90 expression for LOY (blue) and ROY (orange) clones, with isotype controls shown. (I) Dot plot of top 10 Hallmark gene sets from preranked GSEA of TCGA LUAD samples (LOY vs. ROY). (J) Dot plot the top 8 positively enriched Hallmark gene sets from GSEA of the LuCA single-cell dataset (LOY vs. ROY tumor cells).

    Journal: bioRxiv

    Article Title: Loss of the Y chromosome drives epigenetic and transcriptomic plasticity in lung adenocarcinoma

    doi: 10.64898/2026.06.02.729627

    Figure Lengend Snippet: (A) Experimental overview illustrating the generation of isogenic single-cell LOY and ROY clones from parental A549 cells and the multi-omic analysis of clones and patients. (B) Representative WGS profiles of ROY (top, orange) and LOY (bottom, blue) clones. Left: zoomed-in view of the Y chromosome. Right: genome-wide Circos plots (right). (C) Volcano plot of differentially expressed genes between LOY (n=4) and ROY (n=4) clones (Y-linked genes excluded). X-axis: log2 fold change; y-axis: -log 10 (p-value). Blue: significantly upregulated genes in LOY; orange: downregulated in LOY. (D) Dot plot showing the top 6 Hallmark gene sets with FDR<0.25 from preranked GSEA of RNA-seq data. X-axis: normalized enrichment score (NES); y-axis: gene sets. Dot size indicates gene count; color represents -log 10 (FDR). (E) Heatmap of lead genes contributing to the EMT gene set enrichment. TPM values are z-scored across clones. (F) Dot plot of Hallmark gene sets from GSEA of full proteome data at 70% confluency (left) and 100% confluency (right). X-axis: normalized enrichment score (NES); y-axis: gene sets. Dot size indicates protein count; color represents -log 10 (FDR). ( G ) Confocal microscopy images of clones stained for N-cadherin (green). Nuclei are counterstained with DAPI (4′,6-diamidino-2-phenylindole, blue). Scale bar 20 µm (H) . Flow cytometry histograms of CD90 expression for LOY (blue) and ROY (orange) clones, with isotype controls shown. (I) Dot plot of top 10 Hallmark gene sets from preranked GSEA of TCGA LUAD samples (LOY vs. ROY). (J) Dot plot the top 8 positively enriched Hallmark gene sets from GSEA of the LuCA single-cell dataset (LOY vs. ROY tumor cells).

    Article Snippet: The sorted CD45 + and CD45 neg cells derived from paired distal normal lung and lung adenocarcinoma samples were used for single-cell RNA sequencing analysis (10X Genomics, Single Cell 3′ Gene Expression v3.1).

    Techniques: Single Cell, Clone Assay, Genome Wide, RNA Sequencing, Confocal Microscopy, Staining, Flow Cytometry, Expressing

    (A) Experimental workflow for single-cell profiling of isogenic A549 ROY and LOY clones using Epi-CyTOF and scMultiome, alongside clinical data reanalysis . (B) Heatmap of Epi-CyTOF histone modification measurements. Values are z-scored across clones; blue: lower-than-average; red: higher-than-average levels. Hierarchical clustering was applied to histone marks and samples. (C) Boxplot showing the epigenetic heterogeneity metric derived from multidimensional Epi-CyTOF data. (D) Boxplot of EMT module scores from snRNA-seq, based on lead genes from . (E) Heatmaps of lead EMT gene expression (snRNA-seq, left) and corresponding chromatin accessibility at gene promoters (scATACseq, right). (F) Boxplot of transcriptional heterogeneity (QuoTHiC) in premalignant and tumor cells compared to normal AT2 cells in a cohort from the LuCA dataset , . (G) Boxplot comparing QuoTHiC scores across cell types and ROY/LOY status from the cohort shown in (F).

    Journal: bioRxiv

    Article Title: Loss of the Y chromosome drives epigenetic and transcriptomic plasticity in lung adenocarcinoma

    doi: 10.64898/2026.06.02.729627

    Figure Lengend Snippet: (A) Experimental workflow for single-cell profiling of isogenic A549 ROY and LOY clones using Epi-CyTOF and scMultiome, alongside clinical data reanalysis . (B) Heatmap of Epi-CyTOF histone modification measurements. Values are z-scored across clones; blue: lower-than-average; red: higher-than-average levels. Hierarchical clustering was applied to histone marks and samples. (C) Boxplot showing the epigenetic heterogeneity metric derived from multidimensional Epi-CyTOF data. (D) Boxplot of EMT module scores from snRNA-seq, based on lead genes from . (E) Heatmaps of lead EMT gene expression (snRNA-seq, left) and corresponding chromatin accessibility at gene promoters (scATACseq, right). (F) Boxplot of transcriptional heterogeneity (QuoTHiC) in premalignant and tumor cells compared to normal AT2 cells in a cohort from the LuCA dataset , . (G) Boxplot comparing QuoTHiC scores across cell types and ROY/LOY status from the cohort shown in (F).

    Article Snippet: The sorted CD45 + and CD45 neg cells derived from paired distal normal lung and lung adenocarcinoma samples were used for single-cell RNA sequencing analysis (10X Genomics, Single Cell 3′ Gene Expression v3.1).

    Techniques: Single Cell, Clone Assay, Modification, Derivative Assay, Gene Expression

    (A) Schematic of the in vitro phenotypic characterization of isogenic A549 ROY and LOY clones. (B) Dot plot showing the top 10 Hallmark gene sets with FDR<0.25 from preranked GSEA of RNA-seq data comparing A549 LOY and ROY under glucose deprivation. X-axis: normalized enrichment score (NES); y-axis: gene sets. Dot size indicates gene count; color represents -log 10 (FDR). ( C) Dot plot showing significant Hallmark gene sets from preranked GSEA of global proteome data comparing LOY vs. ROY clones under glucose (left) and glutamine (right) deprivation. Dot size indicates protein count; color represents -log 10 (FDR). (D) Colony formation capacity under glutamine deprivation. Left: Boxplot of mean colony number (n = 3 technical replicates/clone). Right: Representative crystal violet-stained images. (E ) Normalized dose-response curves of four LOY (blue) and four ROY (orange) clones assessed 24 hours post-irradiation (0-40 Gy). Viability was measured in triplicate using CellTiter-Blue and fitted using non-linear regression. (F) Clonogenic survival following 10 Gy. Left: boxplots showing mean colony counts across two independent experiments (n=3 replicates/clone/experiment). Right: representative images from experiment 1. Note: For all boxplots, the center line represents the median, box limits represent upper and lower quartiles, and whiskers represent minimum and maximum values. Statistical significance was assessed using an unpaired t-test (α=0.05).

    Journal: bioRxiv

    Article Title: Loss of the Y chromosome drives epigenetic and transcriptomic plasticity in lung adenocarcinoma

    doi: 10.64898/2026.06.02.729627

    Figure Lengend Snippet: (A) Schematic of the in vitro phenotypic characterization of isogenic A549 ROY and LOY clones. (B) Dot plot showing the top 10 Hallmark gene sets with FDR<0.25 from preranked GSEA of RNA-seq data comparing A549 LOY and ROY under glucose deprivation. X-axis: normalized enrichment score (NES); y-axis: gene sets. Dot size indicates gene count; color represents -log 10 (FDR). ( C) Dot plot showing significant Hallmark gene sets from preranked GSEA of global proteome data comparing LOY vs. ROY clones under glucose (left) and glutamine (right) deprivation. Dot size indicates protein count; color represents -log 10 (FDR). (D) Colony formation capacity under glutamine deprivation. Left: Boxplot of mean colony number (n = 3 technical replicates/clone). Right: Representative crystal violet-stained images. (E ) Normalized dose-response curves of four LOY (blue) and four ROY (orange) clones assessed 24 hours post-irradiation (0-40 Gy). Viability was measured in triplicate using CellTiter-Blue and fitted using non-linear regression. (F) Clonogenic survival following 10 Gy. Left: boxplots showing mean colony counts across two independent experiments (n=3 replicates/clone/experiment). Right: representative images from experiment 1. Note: For all boxplots, the center line represents the median, box limits represent upper and lower quartiles, and whiskers represent minimum and maximum values. Statistical significance was assessed using an unpaired t-test (α=0.05).

    Article Snippet: The sorted CD45 + and CD45 neg cells derived from paired distal normal lung and lung adenocarcinoma samples were used for single-cell RNA sequencing analysis (10X Genomics, Single Cell 3′ Gene Expression v3.1).

    Techniques: In Vitro, Clone Assay, RNA Sequencing, Staining, Irradiation

    (A) Boxplots displaying cell proliferation (BrdU ELISA) of four LOY (blue) and four ROY (orange) clones under normal growth conditions (glucose+, glutamine+), glucose deprivation (glucose-, glutamine+), or glutamine deprivation (glucose+, glutamine-). (B) Volcano plot of differentially expressed genes between LOY (n=4) and ROY (n=4) clones under glucose deprivation (top) and glutamine deprivation (bottom) (Y-linked genes excluded). X-axis: log2 fold change; y-axis: -log 10 (p-value). Blue: significantly upregulated genes in LOY; orange: downregulated in LOY. (C) Dot plot showing the top 2 Hallmark gene sets with FDR<0.25 from preranked GSEA of RNA-seq data comparing A549 LOY and ROY under glutamine deprivation. X-axis: normalized enrichment score (NES); y-axis: gene sets. Dot size indicates gene count; color represents -log 10 (FDR). (D) Volcano plots of differentially abundant proteins under glucose (left) and glutamine (right) deprivation. Blue: significantly upregulated in LOY; orange: downregulated in LOY. X-axis: log2 fold change; y-axis: -log 10 (p-value). (E) 10-day colony formation assay of four LOY (blue) and four ROY (orange) clones, standard growth conditions. Left: boxplot of mean colony number (n=3 technical replicates/clone). Right: representative images. (F) Normalized growth curves of four LOY (blue) and four ROY (orange) clones over 5 days following 10 Gy irradiation, fitted using non-linear regression. (G) Boxplot quantifying the area occupied by colonies after 10 Gy irradiation (experiment 1). (H) Boxplot quantifying the area occupied by non-irradiated controls (left) and representative images (right) from experiment 1. Box plots as in .

    Journal: bioRxiv

    Article Title: Loss of the Y chromosome drives epigenetic and transcriptomic plasticity in lung adenocarcinoma

    doi: 10.64898/2026.06.02.729627

    Figure Lengend Snippet: (A) Boxplots displaying cell proliferation (BrdU ELISA) of four LOY (blue) and four ROY (orange) clones under normal growth conditions (glucose+, glutamine+), glucose deprivation (glucose-, glutamine+), or glutamine deprivation (glucose+, glutamine-). (B) Volcano plot of differentially expressed genes between LOY (n=4) and ROY (n=4) clones under glucose deprivation (top) and glutamine deprivation (bottom) (Y-linked genes excluded). X-axis: log2 fold change; y-axis: -log 10 (p-value). Blue: significantly upregulated genes in LOY; orange: downregulated in LOY. (C) Dot plot showing the top 2 Hallmark gene sets with FDR<0.25 from preranked GSEA of RNA-seq data comparing A549 LOY and ROY under glutamine deprivation. X-axis: normalized enrichment score (NES); y-axis: gene sets. Dot size indicates gene count; color represents -log 10 (FDR). (D) Volcano plots of differentially abundant proteins under glucose (left) and glutamine (right) deprivation. Blue: significantly upregulated in LOY; orange: downregulated in LOY. X-axis: log2 fold change; y-axis: -log 10 (p-value). (E) 10-day colony formation assay of four LOY (blue) and four ROY (orange) clones, standard growth conditions. Left: boxplot of mean colony number (n=3 technical replicates/clone). Right: representative images. (F) Normalized growth curves of four LOY (blue) and four ROY (orange) clones over 5 days following 10 Gy irradiation, fitted using non-linear regression. (G) Boxplot quantifying the area occupied by colonies after 10 Gy irradiation (experiment 1). (H) Boxplot quantifying the area occupied by non-irradiated controls (left) and representative images (right) from experiment 1. Box plots as in .

    Article Snippet: The sorted CD45 + and CD45 neg cells derived from paired distal normal lung and lung adenocarcinoma samples were used for single-cell RNA sequencing analysis (10X Genomics, Single Cell 3′ Gene Expression v3.1).

    Techniques: Enzyme-linked Immunosorbent Assay, Clone Assay, RNA Sequencing, Colony Assay, Irradiation

    Single-cell transcriptomic analysis of liver fibrosis. (A) Quality control metrics before cell filtering, including the distribution of gene counts (nFeature_RNA), UMI counts (nCount_RNA), and the percentages of mitochondrial and hemoglobin genes across samples. (B) Cell clustering of liver fibrosis samples. (C) Cell-type annotation of single-cell RNA-seq data. (D) Cell cycle analysis of single-cell transcriptomic data. (E) Proportional changes of different cell types between normal and fibrotic groups. (F) Expression distribution of Acot9, Aldh1b1, and Pck2 across different cell types.

    Journal: Frontiers in Immunology

    Article Title: Identification of mitochondria-related biomarkers in liver fibrosis via interpretable machine learning and WGCNA: transcriptomic analysis and In Vivo validation

    doi: 10.3389/fimmu.2026.1705706

    Figure Lengend Snippet: Single-cell transcriptomic analysis of liver fibrosis. (A) Quality control metrics before cell filtering, including the distribution of gene counts (nFeature_RNA), UMI counts (nCount_RNA), and the percentages of mitochondrial and hemoglobin genes across samples. (B) Cell clustering of liver fibrosis samples. (C) Cell-type annotation of single-cell RNA-seq data. (D) Cell cycle analysis of single-cell transcriptomic data. (E) Proportional changes of different cell types between normal and fibrotic groups. (F) Expression distribution of Acot9, Aldh1b1, and Pck2 across different cell types.

    Article Snippet: Single-cell RNA sequencing (scRNA-seq) datasets were obtained from GSE145086 and GSE233084 , both generated using the 10X Genomics platform ( , ).

    Techniques: Single Cell, Control, RNA Sequencing, Cell Cycle Assay, Expressing